Aerodramus vanikorensis Quoy & Gaimard, 1830

Primary tabs

EOL Text

Common to abundant throughout the range.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784

Barcode data: Aerodramus vanikorensis:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTATACTTAATCTTTGGGGCATGAGCCGGCATGGTCGGAACTGCCCTCAGCTTACTCATCCGAGCAGAACTTGGACAACCAGGGACCCTCCTAGGAGATGACCAAATCTATAACGTGATCGTAACCGCCCATGCTTTCGTCATAATCTTCTTCATGGTTATACCAATCATAATTGGAGGATTCGGGAACTGACTAGTCCCCCTCATAATCGGTGCACCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTACTCCTGCTAGCCTCTTCAACAGTAGAAGCAGGGGCCGGAACAGGATGAACCGTTTACCCCCCACTAGCTGGTAACCTAGCCCACGCAGGAGCATCAGTAGACCTCGCCATCTTCTCCCTTCACCTAGCAGGTGTCTCCTCCATCTTAGGTGCAATTAACTTCATCACAACCGCCATCAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATTACTGCCGTTCTACTACTCCTCTCCCTTCCCGTCCTCGCCGCTGGCATCACCATACTCCTAACCGATCGCAACCTGAACACCACATTCTTCGACCCTGCCGGAGGAGGAGACCCCGTCCTATACCAACATCTA
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=114662

Common to abundant throughout the range.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784

Statistics of barcoding coverage: Aerodramus vanikorensis:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=114662

Highly variable with rump uniform with upperparts in all races except pullens.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784

Uniform swiftlet:

The uniform swiftlet, (Aerodramus vanikorensis), also known as the Vanikoro or lowland swiftlet, is a gregarious, medium-sized swiftlet with a shallowly forked tail. The colouring is dark grey-brown, darker on the upperparts with somewhat paler underparts, especially on chin and throat. This species is widespread from the Philippines through Wallacea, New Guinea and Melanesia. It forages for flying insects primarily in lowland forests and open areas. It nests in caves where it uses its sense of echolocation, rare in birds, to navigate.



Description[edit]

The uniform swiftlet is a gregarious, medium-sized swiftlet with a shallowly forked tail. It is about 13 cm long with a wingspan averaging around 27 cm. It weighs about 11 grams. The colouring is dark grey-brown, darker on the upperparts with paler underparts, especially on chin and throat. It is similar to, and most likely to be confused with, the white-rumped swiftlet or mountain swiftlet.

Taxonomy[edit]

Several subspecies are recognised, and the form A. v. inquietus is often split as the island swiftlet, A. inquietus.

Distribution[edit]

This species is widespread from the Philippines through Wallacea, New Guinea and Melanesia. It has been recorded as a rare vagrant to Australia, from Cape York Peninsula and islands in Torres Strait.

Habitat[edit]

The uniform swiftlet forages over lowland forests and open areas. It roosts in caves and sinkholes, mostly in limestone areas. The caves may be as little as 10 m (33 ft) long but are usually much larger. Sometimes man-made tunnels or structures are used.[2]

Food[edit]

This species feeds on flying insects, especially ants.

Breeding[edit]

This species nests colonially in caves where it uses echolocation to navigate. The nest is a shallow cup of mossy material and saliva, usually attached to a vertical surface of a cave wall in the completely dark zone. On Guam, Neckeropsis lepiniana, is used as the nesting material and in Hawaii, a liverwort (Herberta spp.) is used. One or two white eggs form the clutch. The incubation period is at least twelve days and the young may take thirty-five days to fledge.[2]

Status[edit]

The uniform swiftlet has a very large range and that they are locally common and in some places abundant within that range. The population has not been quantified but is believed to be stable. The birds face no particular threats, and as a result, the IUCN has listed it as being of "Least Concern".[1]

References[edit]

  1. ^ a b BirdLife International (2014). "Aerodramus vanikorensis". IUCN Red List of Threatened Species. Version 2014.2. International Union for Conservation of Nature. Retrieved 29 August 2014. 
  2. ^ a b "The Mariana Swiftlet (Aerodramus bartschi)". Birding Hawaii. 2002. Retrieved 2013-12-23. 
  • Beehler, Bruce M.; & Finch, Brian W. (1985). Species Checklist of the Birds of New Guinea. RAOU Monograph No.1. Royal Australasian Ornithologists Union: Melbourne. ISBN 0-9599823-2-9
  • Beehler, Bruce M.; Pratt, Thane K.; & Zimmerman, Dale A. (1986). Birds of New Guinea. Wau Ecology Handbook No.9. Princeton University Press. ISBN 0-691-02394-8
  • Coates, Brian J. (1985). The Birds of Papua New Guinea. Volume 1: Non-Passerines. Dover Publications: Alderley, Queensland. ISBN 0-9590257-0-7
  • Higgins, P.J. (ed). (1999). Handbook of Australian, New Zealand and Antarctic Birds. Volume 4: Parrots to Dollarbird. Oxford University Press: Melbourne. ISBN 0-19-553071-3
Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Uniform_swiftlet&oldid=630412949

Highly variable with rump uniform with upperparts in all races except pullens.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784

Highly variable with rump uniform with upperparts in all races except pullens.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/content/aerodramus-vanikorensis

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784

Subspecies and Distribution:

    * amelis (Oberholser, 1906) - Luzon, Mindoro, Cebu, Bohol and Mindanao (E Philippines). * palawanensis (Stresemann, 1914) - Palawan (SW Philippines). * aenigma (Riley, 1918) - C Sulawesi. * heinrichi (Stresemann, 1932) - S Sulawesi. * moluccarum (Stresemann, 1914) - Seram, Ambon, Banda, Gorong, Tayandu and Kai Is (S Moluccas). * waigeuensis (Stresemann & Paludan, 1932) - N Moluccas (Morotai, Halmahera) and W Papuan Is (Misool, Batanta, Waigeo and probably Salawati). * steini (Stresemann & Paludan, 1932) - Biak and Numfor (in Geelvink Bay, NW New Guinea). * yorki (Mathews, 1916) - Aru Is, New Guinea and D’Entrecasteaux Is. * tagulae (Mayr, 1937) - Louisiade Archipelago, Trobriand Is and Woodlark I. * coultasi (Mayr, 1937) - Admiralty Is (Manus, Rambutyo, Los Negros) and St Matthias group. * pallens (Salomonsen, 1983) - New Hanover, New Ireland and nearby Djaul I, and New Britain. * lihirensis (Mayr, 1937) - Nuguria and Hibernian Is, Tabar Is, Lihir group and Feni Is (E of New Ireland). * lugubris (Salomonsen, 1983) - Solomon Is. * vanikorensis (Quoy & Gaimard, 1830) - Santa Cruz Is (including Duff Is and Swallow Is) and Vanuatu.
Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorKaterina Tvardikova
Sourcehttp://pngbirds.myspecies.info/node/784
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith